Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDule2-3-nitroTyrosine (A7)
(Plasmid #174079)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 174079 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDule2
  • Backbone size w/o insert (bp) 6082
  • Total vector size (bp) 7003
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    3-nitroTyrosine tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
  • Alt name
    3NY (A7) synthetase
  • Alt name
    3-nitroY (A7) synthetase
  • Alt name
    3-nitroTyr (A7) synthetase
  • Species
    Methanocaldococcus jannaschii
  • Insert Size (bp)
    921
  • Mutation
    Y32H H70T D158H I159A L162R
  • Promoter GlnRS (constitutive)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGTCACTGCGTCTTTTACTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDule2-3-nitroTyrosine (A7) was a gift from Ryan Mehl (Addgene plasmid # 174079 ; http://n2t.net/addgene:174079 ; RRID:Addgene_174079)
  • For your References section:

    Overcoming Near-Cognate Suppression in a Release Factor 1-Deficient Host with an Improved Nitro-Tyrosine tRNA Synthetase. Beyer JN, Hosseinzadeh P, Gottfried-Lee I, Van Fossen EM, Zhu P, Bednar RM, Karplus PA, Mehl RA, Cooley RB. J Mol Biol. 2020 Jul 24;432(16):4690-4704. doi: 10.1016/j.jmb.2020.06.014. Epub 2020 Jun 19. 10.1016/j.jmb.2020.06.014 PubMed 32569745