Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDule2-para-aminoPhe
(Plasmid #85503)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85503 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDule2
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 6300
  • Modifications to backbone
    pDule-para-aminoPhe (Addgene plasmid# 85502) was modified by replacing the tetracycline resistance cassette with a spectinomycin resistance cassette.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    p-aminoPhe tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
  • Alt name
    para-aminoPhenylalanine
  • Alt name
    pAF
  • Alt name
    4-aminoPhenylalanine
  • Species
    Methanocaldococcus jannaschii
  • Insert Size (bp)
    921
  • Mutation
    Y32T, E107T, D158P, I159L, L162A
  • Promoter lpp (constitutive)
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CGTCACTGCGTCTTTTACTG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDule2-para-aminoPhe was a gift from Ryan Mehl (Addgene plasmid # 85503 ; http://n2t.net/addgene:85503 ; RRID:Addgene_85503)
  • For your References section:

    Generation of a bacterium with a 21 amino acid genetic code. Mehl RA, Anderson JC, Santoro SW, Wang L, Martin AB, King DS, Horn DM, Schultz PG. J Am Chem Soc. 2003 Jan 29;125(4):935-9. 10.1021/ja0284153 PubMed 12537491