pDule2-para-aminoPhe
(Plasmid #85503)

• Purpose: Plasmid for incorporating the non-canonical amino acid para-aminoPhe with the Mj pAF synthetase and cognate amber suppressing tRNA in Ecoli.
• Depositing Lab: Ryan Mehl
• Publication: Mehl et al J Am Chem Soc. 2003 Jan 29;125(4):935-9.

Backbone

• Vector backbone: pDule2
• Backbone size w/o insert (bp): 5400
• Total vector size (bp): 6300
• Modifications to backbone: pDule-para-aminoPhe (Addgene plasmid# 85502) was modified by replacing the tetracycline resistance cassette with a spectinomycin resistance cassette.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: p-aminoPhe tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
• Alt name: para-aminoPhenylalanine
• Alt name: pAF
• Alt name: 4-aminoPhenylalanine
• Species: Methanocaldococcus jannaschii
• Insert Size (bp): 921
• Mutation: Y32T, E107T, D158P, I159L, L162A
• Promoter: lpp (constitutive)
• Tag / Fusion Protein:
  • None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: CGTCACTGCGTCTTTTACTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry