Empty Bridge Control Zfp462-Klf4SE
(Plasmid
#127666)
-
PurposeEncodes for 4 gRNAs expressed from their individual hU6 promoters. Two gRNAs target the Zfp462 promoter while the other two target the Klf4 stretch enhancer.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127666 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneDerived from pUC19
-
Backbone manufacturerCremins lab
- Backbone size w/o insert (bp) 3308
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNAs 129, 135, 115, 117
-
gRNA/shRNA sequenceTACATGCAGTAGTACTAAGT, TTTGTGTTTTAGTGTAGATT, TAAAGAAAAGTGTTTATCGA, AAGTGTTTATCGAGGGAAAG
-
SpeciesSynthetic
-
Insert Size (bp)1752
- Promoter hU6
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer pBR322ori-F
- 3′ sequencing primer BGH Reverse (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Empty Bridge Control Zfp462-Klf4SE was a gift from Jennifer Phillips-Cremins (Addgene plasmid # 127666 ; http://n2t.net/addgene:127666 ; RRID:Addgene_127666) -
For your References section:
LADL: light-activated dynamic looping for endogenous gene expression control. Kim JH, Rege M, Valeri J, Dunagin MC, Metzger A, Titus KR, Gilgenast TG, Gong W, Beagan JA, Raj A, Phillips-Cremins JE. Nat Methods. 2019 Jun 24. pii: 10.1038/s41592-019-0436-5. doi: 10.1038/s41592-019-0436-5. 10.1038/s41592-019-0436-5 PubMed 31235883