Skip to main content

pACYC-TtCas6-4xcrRNA4.5
(Plasmid #127764)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127764 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pACYCDuet-1
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 3920
  • Total vector size (bp) 4977
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Synthetic CRISPR array containing four identical T. thermophilus spacers
  • Species
    Synthetic; Thermus thermophilus HB8
  • Insert Size (bp)
    340
  • GenBank ID
    AP008227.1 (144467 to 144542)
  • Promoter T7

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer N/A
  • 3′ sequencing primer GATTATGCGGCCGTGTACAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Cas6A
  • Alt name
    TTHA0078
  • Alt name
    Cas6 endonuclease
  • Species
    Synthetic; Thermus thermophilus HB8
  • Insert Size (bp)
    4977
  • Mutation
    Codon optimized for expression in E. coli
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer N/A
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACYC-TtCas6-4xcrRNA4.5 was a gift from Jennifer Doudna (Addgene plasmid # 127764 ; http://n2t.net/addgene:127764 ; RRID:Addgene_127764)
  • For your References section:

    Target preference of Type III-A CRISPR-Cas complexes at the transcription bubble. Liu TY, Liu JJ, Aditham AJ, Nogales E, Doudna JA. Nat Commun. 2019 Jul 5;10(1):3001. doi: 10.1038/s41467-019-10780-2. 10.1038/s41467-019-10780-2 PubMed 31278272