Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pThermoCas9_ctrl
(Plasmid #100981)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100981 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pNW33n
  • Backbone size w/o insert (bp) 4217
  • Total vector size (bp) 7467
  • Modifications to backbone
    Removal of a 810nt long redundant fragment from the backbone
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Culture medium: LB + 25ug/ml chloramphenicol
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Cas9 from the type IIc CRISPR-Cas sytem of Geobacillus thermodenitrificans T12 strain
  • Alt name
    ThermoCas9
  • Species
    Geobacillus thermodenitrificans T12
  • Insert Size (bp)
    3249
  • GenBank ID
    ARP41326.1
  • Promoter B. smithii xylL promoter
  • Tag / Fusion Protein
    • None

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGAAGTATAAAATCGGTCTTG
  • 3′ sequencing primer TTATAACGGACGGATAGTTTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ThermoCas9 single guide RNA expressing module
  • Alt name
    sgRNA
  • Species
    Geobacillus thermodenitrificans T12
  • Insert Size (bp)
    192
  • Promoter B. coagulans DSM 1 pta promoter
  • Tag / Fusion Protein
    • None

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggatcccatgacgctagtatccagctggGTCATAGTTCCCCTGAGAT
  • 3′ sequencing primer CCCTCCCATGCACAATAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2017/08/18/177717 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pThermoCas9_ctrl was a gift from John van der Oost (Addgene plasmid # 100981 ; http://n2t.net/addgene:100981 ; RRID:Addgene_100981)
  • For your References section:

    Characterizing a thermostable Cas9 for bacterial genome editing and silencing. Mougiakos I, Mohanraju P, Bosma EF, Vrouwe V, Finger Bou M, Naduthodi MIS, Gussak A, Brinkman RBL, van Kranenburg R, van der Oost J. Nat Commun. 2017 Nov 21;8(1):1647. doi: 10.1038/s41467-017-01591-4. 10.1038/s41467-017-01591-4 [pii] PubMed 29162801