pThermoCas9i_ctrl
(Plasmid #100982)

• Purpose: Expresses the catalytically inactive version of ThermoCas9 (Thermo(d)Cas9) and its sgRNA module
• Depositing Lab: John van der Oost
• Publication: Mougiakos et al Nat Commun. 2017 Nov 21;8(1):1647. doi: 10.1038/s41467-017-01591-4.

Backbone

• Vector backbone: pNW33n
• Backbone size w/o insert (bp): 4217
• Total vector size (bp): 7467
• Modifications to backbone: Removal of a 810nt long redundant fragment from the backbone
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Culture medium: LB + 25ug/ml chloramphenicol
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Catalytically inactive variant of the Cas9 from the type IIc CRISPR-Cas sytem of Geobacillus thermodenitrificans T12 strain
• Alt name: Thermo(d)Cas9
• Species: Geobacillus thermodenitrificans T12
• Insert Size (bp): 3249
• Mutation: changed aspartate 8 to alanine and histidine 582 to alanine
• GenBank ID: ARP41326.1
• Promoter: B. smithii xylL promoter
• Tag / Fusion Protein:
  • None

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGAAGTATAAAATCGGTCTTG
• 3′ sequencing primer: TTATAACGGACGGATAGTTTC

Gene/Insert 2

• Gene/Insert name: ThermoCas9 single guide RNA expressing module
• Alt name: sgRNA
• Species: Geobacillus thermodenitrificans T12
• Insert Size (bp): 192
• Promoter: B. coagulans DSM 1 pta promoter
• Tag / Fusion Protein:
  • None

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggatcccatgacgctagtatccagctggGTCATAGTTCCCCTGAGAT
• 3′ sequencing primer: CCCTCCCATGCACAATAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2017/08/18/177717 for bioRxiv preprint.