pX330 Human 3' HP1a gRNA
(Plasmid
#127907)
-
PurposeWT Cas9 Vector targeting the 3' end of the human HP1a gene
-
Depositing Lab
-
Depositing OrganizationFred Hutchinson Cancer Center
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127907 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 127907-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 127907-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA for Human 3' HP1a
-
gRNA/shRNA sequenceacagcaaagagctaaaggag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer cacctctgacttgagcgtcg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhttps://www.addgene.org/42230/
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 127907-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 127907-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330 Human 3' HP1a gRNA was a gift from Mark Groudine (Addgene plasmid # 127907 ; http://n2t.net/addgene:127907 ; RRID:Addgene_127907) -
For your References section:
HP1alpha is a chromatin crosslinker that controls nuclear and mitotic chromosome mechanics. Strom AR, Biggs RJ, Banigan EJ, Wang X, Chiu K, Herman C, Collado J, Yue F, Ritland Politz JC, Tait LJ, Scalzo D, Telling A, Groudine M, Brangwynne CP, Marko JF, Stephens AD. Elife. 2021 Jun 9;10. pii: 63972. doi: 10.7554/eLife.63972. 10.7554/eLife.63972 PubMed 34106828
