pAC572
(Plasmid
#127973)
-
PurposeAMA1 plasmid with pyrG selection marker, and USER cassette (PacI/Nt.BbvCI)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127973 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonecustom
- Total vector size (bp) 10239
-
Modifications to backboneAMA1 element
-
Vector typeBacterial Expression ; Fungal Expression
-
Selectable markerspyrG
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepyrG
-
SpeciesAspergillus fumigatus
-
Insert Size (bp)905
- Promoter native promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GATCTCATGGTCATAGCTGTTTCC
- 3′ sequencing primer GTGTCGCCCTTATTCGACTCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
AMA1 is a palindrome which causes issues sequencing. There are a few nucleotides with a mixed population. This however does not affect plasmid function.
Published in: Nødvig CS, Hoof JB, Kogle ME, Jarczynska ZD, Lehmbeck J, Klitgaard DK, et al. Efficient oligo nucleotide mediated CRISPR-Cas9 gene editing in Aspergilli. Fungal Genet Biol. 2018;115:78–89, https://doi.org/10.1016/j.fgb.2018.01.004.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC572 was a gift from Uffe Mortensen (Addgene plasmid # 127973 ; http://n2t.net/addgene:127973 ; RRID:Addgene_127973) -
For your References section:
Cpf1 enables fast and efficient genome editing in Aspergilli. Vanegas KG, Jarczynska ZD, Strucko T, Mortensen UH. Fungal Biol Biotechnol. 2019 May 1;6:6. doi: 10.1186/s40694-019-0069-6. eCollection 2019. 10.1186/s40694-019-0069-6 PubMed 31061713