Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAC574
(Plasmid #127975)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 127975 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    custom
  • Total vector size (bp) 10046
  • Modifications to backbone
    AMA1 element
  • Vector type
    Bacterial Expression ; Fungal Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hygB (hygromycin resistance marker)
  • Species
    Escherichia coli
  • Insert Size (bp)
    1026
  • Promoter Aspergillus nidulans trpC promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GATCTCATGGTCATAGCTGTTTCC
  • 3′ sequencing primer GTGTCGCCCTTATTCGACTCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

AMA1 is a palindrome which causes issues sequencing. There are a few nucleotides with a mixed population. This however does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC574 was a gift from Uffe Mortensen (Addgene plasmid # 127975 ; http://n2t.net/addgene:127975 ; RRID:Addgene_127975)
  • For your References section:

    Cpf1 enables fast and efficient genome editing in Aspergilli. Vanegas KG, Jarczynska ZD, Strucko T, Mortensen UH. Fungal Biol Biotechnol. 2019 May 1;6:6. doi: 10.1186/s40694-019-0069-6. eCollection 2019. 10.1186/s40694-019-0069-6 PubMed 31061713