Skip to main content

pAC575
(Plasmid #127976)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127976 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    custom
  • Total vector size (bp) 10152
  • Modifications to backbone
    AMA1 element
  • Vector type
    Bacterial Expression ; Fungal Expression
  • Selectable markers
    Zeocin ; Bleomycin ; Phleomycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ble (bleomycin resistance marker)
  • Species
    Streptoalloteichus hindustanus
  • Insert Size (bp)
    375
  • Promoter Aspergillus nidulans trpC promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GATCTCATGGTCATAGCTGTTTCC
  • 3′ sequencing primer GTGTCGCCCTTATTCGACTCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

AMA1 sequence contains multiple ambiguous bases that are likely mixed nucleotide populations. AMA1 is a palindrome and thus difficult to sequence. Dep. confirms the mixed population does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC575 was a gift from Uffe Mortensen (Addgene plasmid # 127976 ; http://n2t.net/addgene:127976 ; RRID:Addgene_127976)
  • For your References section:

    Cpf1 enables fast and efficient genome editing in Aspergilli. Vanegas KG, Jarczynska ZD, Strucko T, Mortensen UH. Fungal Biol Biotechnol. 2019 May 1;6:6. doi: 10.1186/s40694-019-0069-6. eCollection 2019. 10.1186/s40694-019-0069-6 PubMed 31061713