Skip to main content

pAC1748
(Plasmid #127982)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127982 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAC573
  • Backbone size w/o insert (bp) 10868
  • Total vector size (bp) 16125
  • Vector type
    Bacterial Expression, CRISPR ; Fungal Expression
  • Selectable markers
    argB

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cpf1
  • Alt name
    Lb_Cpf1 ; Cas12a
  • Species
    Synthetic; Lachnospiraceae bacterium
  • Insert Size (bp)
    3846
  • Mutation
    codon optimized for Aspergillus nidulans
  • Promoter Aspergillus nidulans tef1 promoter
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CTTCTCTGCTCAGCACCTCTACG
  • 3′ sequencing primer GCTTTACGGGAAGAGCTGAGAT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The cpf1 gene contained in the vector is custom made version that we bought from Thermo Fisher Scientific.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC1748 was a gift from Uffe Mortensen (Addgene plasmid # 127982 ; http://n2t.net/addgene:127982 ; RRID:Addgene_127982)
  • For your References section:

    Cpf1 enables fast and efficient genome editing in Aspergilli. Vanegas KG, Jarczynska ZD, Strucko T, Mortensen UH. Fungal Biol Biotechnol. 2019 May 1;6:6. doi: 10.1186/s40694-019-0069-6. eCollection 2019. 10.1186/s40694-019-0069-6 PubMed 31061713