Skip to main content
Addgene

pcDNA3.1+ Flag-RAGB99L
(Plasmid #128101)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128101 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1+
  • Backbone manufacturer
    invitrogen
  • Backbone size w/o insert (bp) 5359
  • Total vector size (bp) 6468
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    The depositing lab used the strain Top10 in their studies.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Ras related GTP binding B
  • Alt name
    RAGB
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1109
  • Mutation
    Q99L (CAA to CTA)
  • GenBank ID
    NM_006064
  • Entrez Gene
    RRAGB (a.k.a. RAGB, bA465E19.1)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer CMV-F (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer BGH-Rev (TAGAAGGCACAGTCGAGG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Flag pLJM1 RagB 99L (David Sabatini, Addgene plasmid #19315) and pcDNA3.1+ (invitrogen)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1+ Flag-RAGB99L was a gift from Chi Van Dang (Addgene plasmid # 128101 ; http://n2t.net/addgene:128101 ; RRID:Addgene_128101)
  • For your References section:

    Acid Suspends the Circadian Clock in Hypoxia through Inhibition of mTOR. Walton ZE, Patel CH, Brooks RC, Yu Y, Ibrahim-Hashim A, Riddle M, Porcu A, Jiang T, Ecker BL, Tameire F, Koumenis C, Weeraratna AT, Welsh DK, Gillies R, Alwine JC, Zhang L, Powell JD, Dang CV. Cell. 2018 Jun 28;174(1):72-87.e32. doi: 10.1016/j.cell.2018.05.009. Epub 2018 May 31. 10.1016/j.cell.2018.05.009 PubMed 29861175