pcDNA3.1+ Flag-RAGB99L
(Plasmid
#128101)
-
PurposeExpresses constitutively GTP-bound RAGB in mammalian cells in a G418-selectable plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128101 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1+
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 5359
- Total vector size (bp) 6468
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsThe depositing lab used the strain Top10 in their studies.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRas related GTP binding B
-
Alt nameRAGB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1109
-
MutationQ99L (CAA to CTA)
-
GenBank IDNM_006064
-
Entrez GeneRRAGB (a.k.a. RAGB, bA465E19.1)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer CMV-F (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer BGH-Rev (TAGAAGGCACAGTCGAGG) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFlag pLJM1 RagB 99L (David Sabatini, Addgene plasmid #19315) and pcDNA3.1+ (invitrogen)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1+ Flag-RAGB99L was a gift from Chi Van Dang (Addgene plasmid # 128101 ; http://n2t.net/addgene:128101 ; RRID:Addgene_128101) -
For your References section:
Acid Suspends the Circadian Clock in Hypoxia through Inhibition of mTOR. Walton ZE, Patel CH, Brooks RC, Yu Y, Ibrahim-Hashim A, Riddle M, Porcu A, Jiang T, Ecker BL, Tameire F, Koumenis C, Weeraratna AT, Welsh DK, Gillies R, Alwine JC, Zhang L, Powell JD, Dang CV. Cell. 2018 Jun 28;174(1):72-87.e32. doi: 10.1016/j.cell.2018.05.009. Epub 2018 May 31. 10.1016/j.cell.2018.05.009 PubMed 29861175