-
PurposeExpression construct for MS2 phage like particles with Esp3I cloning sites for packaged RNA.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128233 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepMX
-
Backbone manufacturerLife Technologies
- Backbone size w/o insert (bp) 2200
- Total vector size (bp) 4630
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameMaturation Protein
-
Alt nameA-Protein
-
SpeciesMS2 Phage
- Promoter T7
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GATGTGCTGCAAGGCGATTAAGTTG
- 3′ sequencing primer ctatggaaaaacgccagcaacg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCoat Protein Dimer
-
SpeciesSynthetic
-
Insert Size (bp)801
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GATGTGCTGCAAGGCGATTAAGTTG
- 3′ sequencing primer ctatggaaaaacgccagcaacg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMC037-HisMS2_PLP_pac was a gift from Paul Freemont (Addgene plasmid # 128233 ; http://n2t.net/addgene:128233 ; RRID:Addgene_128233) -
For your References section:
Bacteriophage MS2 displays unreported capsid variability assembling T = 4 and mixed capsids. de Martin Garrido N, Crone MA, Ramlaul K, Simpson PA, Freemont PS, Aylett CHS. Mol Microbiol. 2019 Oct 16. doi: 10.1111/mmi.14406. 10.1111/mmi.14406 PubMed 31618483