pDN-D2irTN2AG5kwh
(Plasmid
#128253)
-
PurposeMammalian linearizer gene circuit in a Flp-In expression system based on negative feedback. The hTetR and EGFP is separated by a P2A motif.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128253 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDN-D2irTNG5kwh
-
Backbone manufacturerCustom
- Backbone size w/o insert (bp) 7505
- Total vector size (bp) 7547
-
Vector typeMammalian Expression, Synthetic Biology ; Flp-In expression vector
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBeta Globin Intron::hTetR::P2A::EGFP
-
Alt nameBeta Globin Intron
-
Alt nameHumanized Tetracycline Repressor
-
Alt nameEGFP
-
SpeciesSynthetic
-
Insert Size (bp)2817
- Promoter CMV D2ir promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ACGGGCCAGATATACGCGTT
- 3′ sequencing primer CCATAGAGCCCACCGCATCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe human codon-optimized TetR regulator was previously developed in pDN-D2irTNG4kwh (Addgene plasmid # 44722; Nevozhay et al Nat Commun. 2013 Feb 5;4:1451. doi: 10.1038/ncomms2471).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid encodes a mammalian synthetic gene circuit with the humanized Tetracycline Repressor (hTetR) regulator separated from EGFP by a P2A motif, which is controlled by a CMV-derived promoter containing 2 tetO2 sites. With hTetR binding to the promoter, negative feedback lowers gene expression noise while linearizing the mean dose response. The circuit is also called mNF-GFP and is within a Flp-In expression vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDN-D2irTN2AG5kwh was a gift from Gabor Balazsi (Addgene plasmid # 128253 ; http://n2t.net/addgene:128253 ; RRID:Addgene_128253) -
For your References section:
Role of network-mediated stochasticity in mammalian drug resistance. Farquhar KS, Charlebois DA, Szenk M, Cohen J, Nevozhay D, Balazsi G. Nat Commun. 2019 Jun 24;10(1):2766. doi: 10.1038/s41467-019-10330-w. 10.1038/s41467-019-10330-w PubMed 31235692