pMTG04-AmpFRT
(Plasmid
#128273)
-
PurposeDeg-LITer1.0 gene circuit with the following architecture: CMV-TetOx2-TetR-LOV-RRRG---CMV-TetOx2-GFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128273 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCB-D2ir-GKwh-D2irTN5kwh
- Total vector size (bp) 6570
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameTetR-LOV-RRRG
-
Alt nameTetracycline repressor, Light-oxygen-voltage-sensing domain, RRRG degron
-
SpeciesSynthetic
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site AgeI (unknown if destroyed)
- 5′ sequencing primer tttttggctactacacttg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEGFP
-
SpeciesSynthetic
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer CCTACGGCAAGCTGACCCTGAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Additional relevant information can be found from this publciation: Nevozhay et al Nat Commun. 2013 Feb 5;4:1451. doi: 10.1038/ncomms2471
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMTG04-AmpFRT was a gift from Gabor Balazsi (Addgene plasmid # 128273 ; http://n2t.net/addgene:128273 ; RRID:Addgene_128273) -
For your References section:
Noise-reducing optogenetic negative-feedback gene circuits in human cells. Guinn MT, Balazsi G. Nucleic Acids Res. 2019 Jul 3. pii: 5527975. doi: 10.1093/nar/gkz556. 10.1093/nar/gkz556 PubMed 31269201