pSB700-ACTC1-Puro
              
              
                (Plasmid
                
                #128324)
              
            
            
            
          - 
            PurposeSP-dCas9 compatible gRNA to be used as a positive control for activation experiments (human cells)
- 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128324 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepSB700-puro
- Total vector size (bp) 9000
- 
              Vector typeMammalian Expression
- 
                Selectable markersPuromycin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature30°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert namegRNA against human ACTC1
- 
                    gRNA/shRNA sequenceTGGCGCCCTGCCCTCTGCTG
- 
                    SpeciesH. sapiens (human)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pSB700-ACTC1-Puro was a gift from Alejandro Chavez (Addgene plasmid # 128324 ; http://n2t.net/addgene:128324 ; RRID:Addgene_128324)
 
    
