This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pXPR_011
(Plasmid #59702)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59702 Plasmid sent as bacteria in agar stab 1 $65
Lentiviral Prep 59702-LV Virus (1mL at titer > 1x10⁶ TU/mL)
and Plasmid. More Information
$250

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1
  • Total vector size (bp) 8395
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP sgRNA
  • Species
    Synthetic
  • Promoter hU6

Cloning Information

Resource Information

Depositor Comments

This lentiviral vector can be used to assay Cas9 activity. In the absence of Cas9, the cells are both resistant to puromycin and express EGFP. In the presence of functional levels of Cas9, the sgRNA expressed from the U6 cassette targets EGFP, and thus cells will still be puromycin-resistant, but will no longer express EGFP. The fraction of EGFP-positive and -negative cells can be accurately quantitated by flow cytometry. Please note that it is unlikely that 100% of cells will ever be EGFP-negative, as a fraction of cells are likely to have in-frame indels, and those the cells may still be green. This assay is best done with cells infected with pXPR_011 at an MOI <1.

Information for Lentiviral Prep (Catalog # 59702-LV) ( Back to top )

Purpose

Ready-to-use Lentiviral Prep particles produced from pXPR_011 (#59702). In addition to the viral particles, you will also receive purified pXPR_011 plasmid DNA.

Lentiviral particles carrying a GFP and puromycin resistance. This virus can be used as a control for assessing Cas9 activity.

Delivery

  • Volume 1mL
  • Titer ≥1x10⁶ TU/mL
  • Pricing $220 USD for preparation of 1mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer DMEM +10% FBS
  • Selectable Marker Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Colony formation assay: A549 cells were transduced with serial dilutions of 59702-LV and treated with puromycin. Puromycin-resistant colonies were expanded for approximately 2 weeks, stained with crystal violet, and counted.
Notes:
  • PCR confirmation of insert: PCR confirmation of insert: PCR was carried out with primers targeting the GFP and WPRE. The PCR product was visualized on an agarose gel for size confirmation.
    Forward Primer: EGFP-C CATGGTCCTGCTGGAGTTCGTG
    Reverse Primer: WPRE-R CATAGCGTAAAAGGAGCAACA
  • Confirmation of protein expression: HeLa cells were transduced with 59702-LV. 96 hours later, GFP expression was visualized with direct fluorescence. You can view the GFP expression here or in the image section at the top of this page.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_011 was a gift from John Doench & David Root (Addgene plasmid # 59702)
  • For your References section:

    Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Doench JG, Hartenian E, Graham DB, Tothova Z, Hegde M, Smith I, Sullender M, Ebert BL, Xavier RJ, Root DE. Nat Biotechnol. 2014 Sep 3. doi: 10.1038/nbt.3026. 10.1038/nbt.3026 PubMed 25184501