pFB-U6-beta2 RD-1-gRNA-hSyn-mCherry-WPRE-SV40pA
(Plasmid
#128343)
-
PurposepAAV encoding gRNA sequence for loss-of-function indels
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128343 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneMLM3636
-
Backbone manufacturerKeith Joung (Addgene plasmid #43860)
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameChrnb2
-
Alt namepFB-U6-Chrnb2-gRNA-hSyn-mCherry-WPRE-SV40pA
-
gRNA/shRNA sequenceATCAGCTTGTTATAGCGGGA
-
SpeciesM. musculus (mouse)
-
Entrez GeneChrnb2 (a.k.a. Acrb-2, Acrb2, C030030P04Rik, [b]2-nAchR)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB-U6-beta2 RD-1-gRNA-hSyn-mCherry-WPRE-SV40pA was a gift from Ryan Drenan (Addgene plasmid # 128343 ; http://n2t.net/addgene:128343 ; RRID:Addgene_128343) -
For your References section:
Gene editing vectors for studying nicotinic acetylcholine receptors in cholinergic transmission. Peng C, Yan Y, Kim VJ, Engle SE, Berry JN, McIntosh JM, Neve RL, Drenan RM. Eur J Neurosci. 2018 May 19. doi: 10.1111/ejn.13957. 10.1111/ejn.13957 PubMed 29779223