pQCXIP-mCherry-TAZ
(Plasmid
#128351)
-
PurposeRetrovirus vector to express mCherry-TAZ
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128351 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQCXIP
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTAZ
-
Alt nameWWTR1
-
SpeciesH. sapiens (human)
-
Entrez GeneWWTR1 (a.k.a. TAZ)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer Ggcatggacgagctgtacaa
- 3′ sequencing primer ccctaggaatgctcgtcaag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pCIneomCherry-TAZ was generated by ligating TAZ(EcoRI/XhoI) into EcoRI/Sall sites of pCIneomCherry. NheI/NotI fragment was ligated inot XbaI/NotI sites of pQCXIP.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQCXIP-mCherry-TAZ was a gift from Yutaka Hata (Addgene plasmid # 128351 ; http://n2t.net/addgene:128351 ; RRID:Addgene_128351)
