Skip to main content

pSF-CjPglB-LpxE
(Plasmid #128389)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128389 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSF
  • Backbone size w/o insert (bp) 3720
  • Total vector size (bp) 6976
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    PglB oligosaccharylktransferase
  • Species
    C. jejuni
  • Insert Size (bp)
    2139
  • Promoter pBAD
  • Tag / Fusion Protein
    • Flag tag (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CGCTTTTTATCGCAACTCTCTACTG
  • 3′ sequencing primer ACAGCCAAGCTGGAGACCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    LpxE phosphatase
  • Species
    F. tularensis
  • Insert Size (bp)
    720
  • Promoter Ptac

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer GGAATTGTGAGCGGATAACAATTTCAC
  • 3′ sequencing primer GCAGTTAGGGATTAGCGTCTTAAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pSF CjPglB backbone is from Ollis, et al. doi.org/10.1038/srep15237; F. tularensis LpxE gene is from pE Needham, et al. doi.org/10.1073/pnas.1218080110

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSF-CjPglB-LpxE was a gift from Michael Jewett (Addgene plasmid # 128389 ; http://n2t.net/addgene:128389 ; RRID:Addgene_128389)
  • For your References section:

    On-demand biomanufacturing of protective conjugate vaccines. Stark JC, Jaroentomeechai T, Moeller TD, Hershewe JM, Warfel KF, Moricz BS, Martini AM, Dubner RS, Hsu KJ, Stevenson TC, Jones BD, DeLisa MP, Jewett MC. Sci Adv. 2021 Feb 3;7(6). pii: 7/6/eabe9444. doi: 10.1126/sciadv.abe9444. Print 2021 Feb. 10.1126/sciadv.abe9444 PubMed 33536221