pCasTet-λ
(Plasmid
#128318)
-
PurposeConstitutive expression of cas9 and anhydrotetracycline/tetracycline inducible expression of lamda RED. Useful variant of Plasmid #62225 when arabinose induction is not possible.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128318 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePlasmid #62225
-
Backbone manufactureraddgene
-
Modifications to backboneReplacement of arabinose inducible lamda RED system with tetracycline/anhydrotetracycline inducible lamda RED system.
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsMust be grown at 30C! Vector has temperature-sensitive replication (RepA101ts)
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTetR and pTetR/TetO
-
SpeciesE. coli
-
Insert Size (bp)818
-
MutationConstitutive expression of cas9 and anhydro-tetracycline/tetracycline inducible expression of LambdaRED and sgR
- Promoter tet promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer caattgatcgtaaacgatatacgtcta
- 3′ sequencing primer ctcaagacgatcctgaatgtaataa (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCasTet-λ was a gift from Christopher Johnston (Addgene plasmid # 128318 ; http://n2t.net/addgene:128318 ; RRID:Addgene_128318) -
For your References section:
Systematic evasion of the restriction-modification barrier in bacteria. Johnston CD, Cotton SL, Rittling SR, Starr JR, Borisy GG, Dewhirst FE, Lemon KP. Proc Natl Acad Sci U S A. 2019 May 16. pii: 1820256116. doi: 10.1073/pnas.1820256116. 10.1073/pnas.1820256116 PubMed 31097593