Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCasTet-λ
(Plasmid #128318)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 128318 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Plasmid #62225
  • Backbone manufacturer
    addgene
  • Modifications to backbone
    Replacement of arabinose inducible lamda RED system with tetracycline/anhydrotetracycline inducible lamda RED system.
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Must be grown at 30C! Vector has temperature-sensitive replication (RepA101ts)
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    TetR and pTetR/TetO
  • Species
    E. coli
  • Insert Size (bp)
    818
  • Mutation
    Constitutive expression of cas9 and anhydro-tetracycline/tetracycline inducible expression of LambdaRED and sgR
  • Promoter tet promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer caattgatcgtaaacgatatacgtcta
  • 3′ sequencing primer ctcaagacgatcctgaatgtaataa
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCasTet-λ was a gift from Christopher Johnston (Addgene plasmid # 128318 ; http://n2t.net/addgene:128318 ; RRID:Addgene_128318)
  • For your References section:

    Systematic evasion of the restriction-modification barrier in bacteria. Johnston CD, Cotton SL, Rittling SR, Starr JR, Borisy GG, Dewhirst FE, Lemon KP. Proc Natl Acad Sci U S A. 2019 May 16. pii: 1820256116. doi: 10.1073/pnas.1820256116. 10.1073/pnas.1820256116 PubMed 31097593