Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pNM58
(Plasmid #128409)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 128409 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pXyl-AgrCA1
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Need to grow cell in minimal medium (S750) with 1% arabinose. This plasmid doesn't work in LB.
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    argCA
  • Species
    Staphylococcus aureus
  • Promoter PxylR

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gacttgtttaatcctgtaatctcagagagag
  • 3′ sequencing primer acttcgcagattattctatactgtgctaac
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    gfpmut2
  • Species
    Synthetic; Staphylococcus aureus
  • Promoter P3

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cctttaccttgtctacaaacccc
  • 3′ sequencing primer GCTGAAGTCAAGTTTGAAGGTGATACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNM58 was a gift from Christopher Voigt (Addgene plasmid # 128409 ; http://n2t.net/addgene:128409 ; RRID:Addgene_128409)
  • For your References section:

    Resilient living materials built by printing bacterial spores. Gonzalez LM, Mukhitov N, Voigt CA. Nat Chem Biol. 2019 Dec 2. pii: 10.1038/s41589-019-0412-5. doi: 10.1038/s41589-019-0412-5. 10.1038/s41589-019-0412-5 PubMed 31792444