pNM58
(Plasmid
#128409)
-
PurposeSystem with AIP and xylose inducible agrCA sensor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128409 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepXyl-AgrCA1
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsNeed to grow cell in minimal medium (S750) with 1% arabinose. This plasmid doesn't work in LB.
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameargCA
-
SpeciesStaphylococcus aureus
- Promoter PxylR
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer gacttgtttaatcctgtaatctcagagagag
- 3′ sequencing primer acttcgcagattattctatactgtgctaac (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namegfpmut2
-
SpeciesSynthetic; Staphylococcus aureus
- Promoter P3
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer cctttaccttgtctacaaacccc
- 3′ sequencing primer GCTGAAGTCAAGTTTGAAGGTGATACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNM58 was a gift from Christopher Voigt (Addgene plasmid # 128409 ; http://n2t.net/addgene:128409 ; RRID:Addgene_128409) -
For your References section:
Resilient living materials built by printing bacterial spores. Gonzalez LM, Mukhitov N, Voigt CA. Nat Chem Biol. 2019 Dec 2. pii: 10.1038/s41589-019-0412-5. doi: 10.1038/s41589-019-0412-5. 10.1038/s41589-019-0412-5 PubMed 31792444