-
PurposeHuman Codon Optimized dCas9-DNMT3A3L
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128424 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 12000
-
Modifications to backbonepcDNA3.1-dCas9-Dnmt3a-Dnmt3l-P2A-eGFP Human codon optimized dCas9-Dnmt3a-Dnmt3l
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9m4-sv40NLS-DNMT3A-3L-sv40NLS-P2A-eGFP
-
SpeciesSynthetic; Streptococcus pyogenes Type II
-
Insert Size (bp)6639
- Promoter T7 Promoter
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GAGCGGATAACAATTTCACACAGG
- 3′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-dCas9-Dnmt3a-Dnmt3l-P2A-eGFP was a gift from Bradley Bernstein (Addgene plasmid # 128424 ; http://n2t.net/addgene:128424 ; RRID:Addgene_128424) -
For your References section:
Epigenome editing strategies for the functional annotation of CTCF insulators. Tarjan DR, Flavahan WA, Bernstein BE. Nat Commun. 2019 Sep 18;10(1):4258. doi: 10.1038/s41467-019-12166-w. 10.1038/s41467-019-12166-w PubMed 31534142