Skip to main content

pPHAGE-CR-NENF-C-TAP
(Plasmid #128511)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128511 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPHAGE C-TAP
  • Backbone size w/o insert (bp) 10056
  • Total vector size (bp) 8360
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NENF
  • Species
    H. sapiens (human)
  • Mutation
    Synonymous silent mutations to F81, Y82, G83 and R85 to block sgRNA seed region binding
  • Entrez Gene
    NENF (a.k.a. CIR2, SCIRP10, SPUF)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG and HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AfeI (not destroyed)
  • 3′ cloning site XcmI (not destroyed)
  • 5′ sequencing primer ATCCACGCTGTTTTGACCTC
  • 3′ sequencing primer AAGAAGCGGAGACGGTTAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPHAGE-CR-NENF-C-TAP was a gift from Mohan Babu (Addgene plasmid # 128511 ; http://n2t.net/addgene:128511 ; RRID:Addgene_128511)
  • For your References section:

    Rewiring of the Human Mitochondrial Interactome during Neuronal Reprogramming Reveals Regulators of the Respirasome and Neurogenesis. Moutaoufik MT, Malty R, Amin S, Zhang Q, Phanse S, Gagarinova A, Zilocchi M, Hoell L, Minic Z, Gagarinova M, Aoki H, Stockwell J, Jessulat M, Goebels F, Broderick K, Scott NE, Vlasblom J, Musso G, Prasad B, Lamantea E, Garavaglia B, Rajput A, Murayama K, Okazaki Y, Foster LJ, Bader GD, Cayabyab FS, Babu M. iScience. 2019 Sep 4;19:1114-1132. doi: 10.1016/j.isci.2019.08.057. 10.1016/j.isci.2019.08.057 PubMed 31536960