Skip to main content

pPHAGE-EF1α-Luc-C20orf24-3’UTR-WT
(Plasmid #128551)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128551 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPHAGE
  • Backbone size w/o insert (bp) 8174
  • Total vector size (bp) 10333
  • Vector type
    Mammalian Expression, Lentiviral, Luciferase
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Firefly luciferase
  • Promoter EF1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggtacagtgcaggggaaaga, tgtttgtggacgaagtaccg
  • 3′ sequencing primer gccttatgcagttgctctcc, gggcggaaggatcaggac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPHAGE-EF1α-Luc-C20orf24-3’UTR-WT was a gift from Mohan Babu (Addgene plasmid # 128551 ; http://n2t.net/addgene:128551 ; RRID:Addgene_128551)
  • For your References section:

    Rewiring of the Human Mitochondrial Interactome during Neuronal Reprogramming Reveals Regulators of the Respirasome and Neurogenesis. Moutaoufik MT, Malty R, Amin S, Zhang Q, Phanse S, Gagarinova A, Zilocchi M, Hoell L, Minic Z, Gagarinova M, Aoki H, Stockwell J, Jessulat M, Goebels F, Broderick K, Scott NE, Vlasblom J, Musso G, Prasad B, Lamantea E, Garavaglia B, Rajput A, Murayama K, Okazaki Y, Foster LJ, Bader GD, Cayabyab FS, Babu M. iScience. 2019 Sep 4;19:1114-1132. doi: 10.1016/j.isci.2019.08.057. 10.1016/j.isci.2019.08.057 PubMed 31536960