Skip to main content

pCDF-5xT7-TtCsm
(Plasmid #128572)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128572 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDF-1b
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 3419
  • Total vector size (bp) 9479
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Streptomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Csm1
  • Alt name
    TTHB147
  • Alt name
    Cas10
  • Species
    Synthetic; Thermus thermophilus
  • Insert Size (bp)
    2433
  • Mutation
    Codon-optimized for expression in E. coli, XhoI site added after stop codon
  • Promoter T7 promoter, lac operator
  • Tag / Fusion Protein
    • Met-Ala-Ser (N terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    Csm2, Csm3, Csm4, Csm5
  • Alt name
    TTHB148, TTHB149, TTHB150, TTHB151
  • Species
    Synthetic; Thermus thermophilus HB8
  • Insert Size (bp)
    3627
  • Mutation
    Codon optimized for expression in E. coli
  • Promoter T7 promoter, lac operator
  • Tag / Fusion Protein
    • HRV 3C protease cleavage site and 10xHis tag on Csm5 (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site AvrII (not destroyed)
  • 5′ sequencing primer GTGAAGGTCGTGATCTGGCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDF-5xT7-TtCsm was a gift from Jennifer Doudna (Addgene plasmid # 128572 ; http://n2t.net/addgene:128572 ; RRID:Addgene_128572)
  • For your References section:

    Target preference of Type III-A CRISPR-Cas complexes at the transcription bubble. Liu TY, Liu JJ, Aditham AJ, Nogales E, Doudna JA. Nat Commun. 2019 Jul 5;10(1):3001. doi: 10.1038/s41467-019-10780-2. 10.1038/s41467-019-10780-2 PubMed 31278272