pLenti-5HRE-GFP NeoR
(Plasmid
#128960)
-
PurposeLentiviral plasmid for expression of hypoxia-responsive enhanced green fluorescent protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128960 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLV 1-5
- Total vector size (bp) 9282
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name5X HRE of VEGF
-
Alt nameVEGF
-
Alt nameVEGFA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1569
-
Entrez GeneVEGFA (a.k.a. L-VEGF, MVCD1, VEGF, VPF)
- Promoter minimal CMV promoter
-
Tag
/ Fusion Protein
- d2EGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGTTTATTACAGGGACAGC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-5HRE-GFP NeoR was a gift from Carlos Carmona-Fontaine (Addgene plasmid # 128960 ; http://n2t.net/addgene:128960 ; RRID:Addgene_128960) -
For your References section:
The MEMIC is an ex vivo system to model the complexity of the tumor microenvironment. Janska L, Anandi L, Kirchberger NC, Marinkovic ZS, Schachtner LT, Guzelsoy G, Carmona-Fontaine C. Dis Model Mech. 2021 Aug 1;14(8). pii: 271783. doi: 10.1242/dmm.048942. Epub 2021 Aug 18. 10.1242/dmm.048942 PubMed 34407185