Skip to main content

pLenti-H2B-iRFP720
(Plasmid #128961)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128961 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LV 1-5
  • Backbone size w/o insert (bp) 5902
  • Total vector size (bp) 7760
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human histone H2B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1868
  • Entrez Gene
    H2BC21 (a.k.a. GL105, H2B, H2B-GL105, H2B.1, H2BE, H2BFQ, H2BGL105, H2BQ, HIST2H2BE)
  • Promoter hPGK
  • Tag / Fusion Protein
    • iRFP720 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATCACCAAGTACACCAGC
  • 3′ sequencing primer ATCCAGAGGTTGATTATCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-H2B-iRFP720 was a gift from Carlos Carmona-Fontaine (Addgene plasmid # 128961 ; http://n2t.net/addgene:128961 ; RRID:Addgene_128961)