pSK221
(Plasmid
#129249)
-
Purposereverse yTRAP, tetR-responsive Neon reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129249 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepNH605
-
Backbone manufacturerWendell Lim
- Backbone size w/o insert (bp) 9632
- Total vector size (bp) 7428
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepADH1(tetO2)-mNeonGreen
-
SpeciesSynthetic
-
Insert Size (bp)2202
- Promoter ADH1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGCTTGTGCATTCGCATGTATCGG
- 3′ sequencing primer taagcaaatagctaaattatatacgaattaatattatgattaag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is the second reporter of the reverse yTRAP system. Use it in combination with an expression clone resulting from pGAN230. pSK221 should be linearized with PmeI enzyme prior to integration into the yeast genome.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSK221 was a gift from Ahmad Khalil (Addgene plasmid # 129249 ; http://n2t.net/addgene:129249 ; RRID:Addgene_129249) -
For your References section:
A Genetic Tool to Track Protein Aggregates and Control Prion Inheritance. Newby GA, Kiriakov S, Hallacli E, Kayatekin C, Tsvetkov P, Mancuso CP, Bonner JM, Hesse WR, Chakrabortee S, Manogaran AL, Liebman SW, Lindquist S, Khalil AS. Cell. 2017 Nov 2;171(4):966-979.e18. doi: 10.1016/j.cell.2017.09.041. Epub 2017 Oct 19. 10.1016/j.cell.2017.09.041 PubMed 29056345