pEGFP-N1-mCherry-ApoB-TagBFP
(Plasmid
#129383)
-
PurposePlasmid bearing the editing target of APOBEC1 fused between the mCherry and the Tag-BFP one. In presence of APOBEC1, the CAA codon in ApoB is edited to a Stop codon (UAA), leading to loss of Tag-BFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129383 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3939
- Total vector size (bp) 5835
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry-ApoB-Tag-BFP
-
SpeciesSynthetic
-
Insert Size (bp)1896
- Promoter CMV promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
- 3′ sequencing primer TTCAGGTTCAGGGGGAGGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-N1-mCherry-ApoB-TagBFP was a gift from Silvestro Conticello (Addgene plasmid # 129383 ; http://n2t.net/addgene:129383 ; RRID:Addgene_129383) -
For your References section:
Live-Cell Quantification of APOBEC1-Mediated RNA Editing: A Comparison of RNA Editing Assays. Chieca M, Torrini S, Conticello SG. Methods Mol Biol. 2021;2181:69-81. doi: 10.1007/978-1-0716-0787-9_5. 10.1007/978-1-0716-0787-9_5 PubMed 32729075