Skip to main content
Addgene

pSC201
(Plasmid #129387)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129387 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSCrhaB2
  • Backbone manufacturer
    Miguel Valvano and Silvia Cardona
  • Backbone size w/o insert (bp) 2836
  • Total vector size (bp) 5461
  • Modifications to backbone
    Removal of replication origin of pSCrhaB2 (pBBR1) and insertion of oriR6K and oriT of pGPΩTp.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Trimethoprim, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir1
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    oriR6K and oriT
  • Species
    E. coli
  • Insert Size (bp)
    2625
  • Mutation
    N/A
  • GenBank ID
    LT827129.1
  • Promoter N/A

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GTTCTATCGCCACGGACG
  • 3′ sequencing primer AACAAGCCAGGGATGTAACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    oriR6K and oriT cloned from pGPΩTp. pGPΩTp constructed by Flannagan et al. (2007). Originally from University of Western Ontario.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pSC201 is referred to as pSC200 in the original publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSC201 was a gift from Silvia Cardona (Addgene plasmid # 129387 ; http://n2t.net/addgene:129387 ; RRID:Addgene_129387)
  • For your References section:

    A putative gene cluster for aminoarabinose biosynthesis is essential for Burkholderia cenocepacia viability. Ortega XP, Cardona ST, Brown AR, Loutet SA, Flannagan RS, Campopiano DJ, Govan JR, Valvano MA. J Bacteriol. 2007 May;189(9):3639-44. doi: 10.1128/JB.00153-07. Epub 2007 Mar 2. 10.1128/JB.00153-07 PubMed 17337576