pSC201
(Plasmid
#129387)
-
PurposeA variant of the pSCrhaB2 vector with the oriR6K and mob genes from pGPΩ-TP. Used for homologous recombination of the rhamnose-inducible system into the chromosome of Burkholderia cenocepacia K56-2.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129387 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSCrhaB2
-
Backbone manufacturerMiguel Valvano and Silvia Cardona
- Backbone size w/o insert (bp) 2836
- Total vector size (bp) 5461
-
Modifications to backboneRemoval of replication origin of pSCrhaB2 (pBBR1) and insertion of oriR6K and oriT of pGPΩTp.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Trimethoprim, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameoriR6K and oriT
-
SpeciesE. coli
-
Insert Size (bp)2625
-
MutationN/A
-
GenBank IDLT827129.1
- Promoter N/A
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GTTCTATCGCCACGGACG
- 3′ sequencing primer AACAAGCCAGGGATGTAACG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byoriR6K and oriT cloned from pGPΩTp. pGPΩTp constructed by Flannagan et al. (2007). Originally from University of Western Ontario.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pSC201 is referred to as pSC200 in the original publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSC201 was a gift from Silvia Cardona (Addgene plasmid # 129387 ; http://n2t.net/addgene:129387 ; RRID:Addgene_129387) -
For your References section:
A putative gene cluster for aminoarabinose biosynthesis is essential for Burkholderia cenocepacia viability. Ortega XP, Cardona ST, Brown AR, Loutet SA, Flannagan RS, Campopiano DJ, Govan JR, Valvano MA. J Bacteriol. 2007 May;189(9):3639-44. doi: 10.1128/JB.00153-07. Epub 2007 Mar 2. 10.1128/JB.00153-07 PubMed 17337576