pSC201
(Plasmid #129387)

• Purpose: A variant of the pSCrhaB2 vector with the oriR6K and mob genes from pGPΩ-TP. Used for homologous recombination of the rhamnose-inducible system into the chromosome of Burkholderia cenocepacia K56-2.
• Depositing Lab: Silvia Cardona
• Publication: Ortega et al J Bacteriol. 2007 May;189(9):3639-44. doi: 10.1128/JB.00153-07. Epub 2007 Mar 2.

Backbone

• Vector backbone: pSCrhaB2
• Backbone manufacturer: Miguel Valvano and Silvia Cardona
• Backbone size w/o insert (bp): 2836
• Total vector size (bp): 5461
• Modifications to backbone: Removal of replication origin of pSCrhaB2 (pBBR1) and insertion of oriR6K and oriT of pGPΩTp.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Trimethoprim
• Growth Temperature: 37°C
• Growth Strain(s): Pir1
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: oriR6K and oriT
• Species: E. coli
• Insert Size (bp): 2625
• Mutation: N/A
• GenBank ID: LT827129.1
• Promoter: N/A

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GTTCTATCGCCACGGACG
• 3′ sequencing primer: AACAAGCCAGGGATGTAACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: oriR6K and oriT cloned from pGPΩTp. pGPΩTp constructed by Flannagan et al. (2007). Originally from University of Western Ontario.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pSC201 is referred to as pSC200 in the original publication.