-
PurposeCytERM-mCherry mRNA reporter tagged with (F30-2xPepper)10
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129403 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCytERM-mCherry-(F30-2xPepper)10
-
SpeciesSynthetic
-
Insert Size (bp)2750
-
GenBank IDMN052906 MN052906
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (destroyed during cloning)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-CytERM-mCherry-(F30-2xPepper)10 was a gift from Samie Jaffrey (Addgene plasmid # 129403 ; http://n2t.net/addgene:129403 ; RRID:Addgene_129403) -
For your References section:
Live imaging of mRNA using RNA-stabilized fluorogenic proteins. Wu J, Zaccara S, Khuperkar D, Kim H, Tanenbaum ME, Jaffrey SR. Nat Methods. 2019 Sep;16(9):862-865. doi: 10.1038/s41592-019-0531-7. Epub 2019 Aug 30. 10.1038/s41592-019-0531-7 PubMed 31471614