-
Purposecircular Pepper RNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129405 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAV U6+27
-
Backbone manufacturerAddgene plasmid # 25709
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecircular F30-Pepper(TAR Variant-2)
-
SpeciesSynthetic
-
Insert Size (bp)275
-
GenBank IDMN052908 MN052908
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sal1 (not destroyed)
- 3′ cloning site Xba1 (not destroyed)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- 3′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAV-U6+27-Tornado-F30-Pepper(TAR Variant-2) was a gift from Samie Jaffrey (Addgene plasmid # 129405 ; http://n2t.net/addgene:129405 ; RRID:Addgene_129405) -
For your References section:
Live imaging of mRNA using RNA-stabilized fluorogenic proteins. Wu J, Zaccara S, Khuperkar D, Kim H, Tanenbaum ME, Jaffrey SR. Nat Methods. 2019 Sep;16(9):862-865. doi: 10.1038/s41592-019-0531-7. Epub 2019 Aug 30. 10.1038/s41592-019-0531-7 PubMed 31471614