Skip to main content

pSH-EFIRES-P-GFP(1-10)opti
(Plasmid #129416)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129416 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSH-EFIRES-P
  • Backbone size w/o insert (bp) 8200
  • Total vector size (bp) 8892
  • Vector type
    Mammalian Expression, CRISPR, TALEN, Unspecified ; Human safe harbor locus (A AVS1) site-specific integration
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    codon-optimized GFP(1-10)
  • Species
    Synthetic
  • Insert Size (bp)
    669
  • Promoter EF-1α

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer tctctccacaggtgtccact
  • 3′ sequencing primer acaccggccttattccaagc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Codon-optimized GFP(1-10) synthesized by Genescript.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This vector was generated by Shiqian Li (Elina Ikonen Lab).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSH-EFIRES-P-GFP(1-10)opti was a gift from Elina Ikonen (Addgene plasmid # 129416 ; http://n2t.net/addgene:129416 ; RRID:Addgene_129416)
  • For your References section:

    Seipin Facilitates Triglyceride Flow to Lipid Droplet and Counteracts Droplet Ripening via Endoplasmic Reticulum Contact. Salo VT, Li S, Vihinen H, Holtta-Vuori M, Szkalisity A, Horvath P, Belevich I, Peranen J, Thiele C, Somerharju P, Zhao H, Santinho A, Thiam AR, Jokitalo E, Ikonen E. Dev Cell. 2019 Jun 6. pii: S1534-5807(19)30388-0. doi: 10.1016/j.devcel.2019.05.016. 10.1016/j.devcel.2019.05.016 PubMed 31178403