p1195-pssAAV.U1a.hNme2Cas9
(Plasmid
#129534)
-
PurposeAAV vector expressing Nme2Cas9
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 129534 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $65 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV
- Backbone size w/o insert (bp) 3326
- Total vector size (bp) 6833
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecodon-optimized Nme2Cas9
- Promoter U1a
-
Tags
/ Fusion Proteins
- 2xNLS (N terminal on insert)
- NLS-3xHA-NLS (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AflII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cgtggccacgcaactcatac
- 3′ sequencing primer ccgccgagtgagagacacaa (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p1195-pssAAV.U1a.hNme2Cas9 was a gift from Erik Sontheimer (Addgene plasmid # 129534 ; http://n2t.net/addgene:129534 ; RRID:Addgene_129534) -
For your References section:
Tissue-restricted Genome Editing in vivo Specified by MicroRNA-repressible Anti-CRISPR Proteins. Lee J, Mou H, Ibraheim R, Liang SQ, Liu P, Xue W, Sontheimer EJ. RNA. 2019 Aug 22. pii: rna.071704.119. doi: 10.1261/rna.071704.119. 10.1261/rna.071704.119 PubMed 31439808