Skip to main content

pLVX-TetOneZeo-ORF18(E36A_L37A)-3xFLAG
(Plasmid #129758)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129758 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLVX
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 9002
  • Total vector size (bp) 9874
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ORF18
  • Species
    Kaposi's sarcoma-associated herpesvirus (HHV-8)
  • Insert Size (bp)
    882
  • Mutation
    changed Glutamic acid 36 to Alanine and Leucine 37 to Alanine
  • Entrez Gene
    ORF18 (a.k.a. HHV8GK18_gp22)
  • Promoter TRE3Gs
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (destroyed during cloning)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer gggcgcctataaaagagtgctg
  • 3′ sequencing primer ctctgacggccctcctgt
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-TetOneZeo-ORF18(E36A_L37A)-3xFLAG was a gift from Britt Glaunsinger (Addgene plasmid # 129758 ; http://n2t.net/addgene:129758 ; RRID:Addgene_129758)
  • For your References section:

    The interaction between ORF18 and ORF30 is required for late gene expression in Kaposi's sarcoma-associated herpesvirus. Castaneda AF, Glaunsinger BA. J Virol. 2018 Oct 10. pii: JVI.01488-18. doi: 10.1128/JVI.01488-18. 10.1128/JVI.01488-18 PubMed 30305361