-
PurposeTransposon based vector that expresses human MYC followed by IRES and firefly luciferase
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129775 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepT3-EF1a
- Total vector size (bp) 9144
-
Modifications to backboneInsertion of human MYC, IRES, and firefly luciferase
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsSlow growing plasmids, grow at least 18 hours.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehuman MYC
-
Alt nameMYC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3700
-
Entrez GeneMYC (a.k.a. MRTL, MYCC, bHLHe39, c-Myc)
- Promoter EF1A
-
Tag
/ Fusion Protein
- luciferase (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byXin Chen (backbone vector)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid contains loxp sites so it´s not ideal for experiments in mice expressing Cre.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT3-EF1A-MYC-IRES-luc was a gift from Amaia Lujambio (Addgene plasmid # 129775 ; http://n2t.net/addgene:129775 ; RRID:Addgene_129775) -
For your References section:
beta-catenin activation promotes immune escape and resistance to anti-PD-1 therapy in hepatocellular carcinoma. Ruiz de Galarreta M, Bresnahan E, Molina-Sanchez P, Lindblad KE, Maier B, Sia D, Puigvehi M, Miguela V, Casanova-Acebes M, Dhainaut M, Villacorta-Martin C, Singhi AD, Moghe A, von Felden J, Tal Grinspan L, Wang S, Kamphorst AO, Monga SP, Brown BD, Villanueva A, Llovet JM, Merad M, Lujambio A. Cancer Discov. 2019 Jun 11. pii: 2159-8290.CD-19-0074. doi: 10.1158/2159-8290.CD-19-0074. 10.1158/2159-8290.CD-19-0074 PubMed 31186238