Skip to main content

pcDNA3-Myd88-CFP
(Plasmid #13026)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 13026 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3-CFP
  • Backbone size w/o insert (bp) 6160
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    myeloid differentiation primary response gene (88)
  • Alt name
    MyD88
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    888
  • GenBank ID
    NM_002468
  • Entrez Gene
    MYD88 (a.k.a. IMD68, MYD88D, WM1)
  • Tag / Fusion Protein
    • CFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI / XhoI (destroyed during cloning)
  • 5′ sequencing primer T7
  • 3′ sequencing primer GTCTTGTAGTTGCCGTCGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'

Please note that the MyD88 insert in this plasmid does not express full-length MyD88 relative to GenBank reference NP_002459.2. This was an intentional result of the cloning strategy employed in constructing this vector. For more information, please see the following publication: https://www.ncbi.nlm.nih.gov/pubmed/12324469

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-Myd88-CFP was a gift from Doug Golenbock (Addgene plasmid # 13026 ; http://n2t.net/addgene:13026 ; RRID:Addgene_13026)