-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 13026 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3-CFP
- Backbone size w/o insert (bp) 6160
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemyeloid differentiation primary response gene (88)
-
Alt nameMyD88
-
SpeciesH. sapiens (human)
-
Insert Size (bp)888
-
GenBank IDNM_002468
-
Entrez GeneMYD88 (a.k.a. IMD68, MYD88D, WM1)
-
Tag
/ Fusion Protein
- CFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI / XhoI (destroyed during cloning)
- 5′ sequencing primer T7
- 3′ sequencing primer GTCTTGTAGTTGCCGTCGTC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'
Please note that the MyD88 insert in this plasmid does not express full-length MyD88 relative to GenBank reference NP_002459.2. This was an intentional result of the cloning strategy employed in constructing this vector. For more information, please see the following publication: https://www.ncbi.nlm.nih.gov/pubmed/12324469
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-Myd88-CFP was a gift from Doug Golenbock (Addgene plasmid # 13026 ; http://n2t.net/addgene:13026 ; RRID:Addgene_13026)