-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 13027 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3-CFP
- Backbone size w/o insert (bp) 6100
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameToll-like Receptor Adaptor Molecule
-
Alt nameTRAM
-
Alt nameTIRP
-
Alt nameTICAM-2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)705
-
GenBank IDBC109266
-
Entrez GeneTICAM2 (a.k.a. MyD88-4, TICAM-2, TIRAP3, TIRP, TRAM)
-
Tag
/ Fusion Protein
- CFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer GTCTTGTAGTTGCCGTCGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-TRAM-CFP was a gift from Doug Golenbock (Addgene plasmid # 13027 ; http://n2t.net/addgene:13027 ; RRID:Addgene_13027)