pLenti-CMV-Blast-DNFGFR1-HA
(Plasmid
#130887)
-
PurposeExpresses dominant negative mutant mouse FGFR1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti CMV Blast DEST
-
Backbone manufacturerEric Campeau & Paul Kaufman (Addgene plasmid # 17451)
- Backbone size w/o insert (bp) 9331
- Total vector size (bp) 8750
-
Modifications to backboneGateway Cloning
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFgfr1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1002
-
MutationDominant Negative receptor lacking cytosolic catalytic domain. First 1002 bp of mouse Fgfr1c-isoform (variant 3, lacking immunoglobulin (Ig)-like domain I)
-
GenBank IDNM_001079909.2
-
Entrez GeneFgfr1 (a.k.a. Eask, FGFR-I, FLG, Fgfr-1, Flt-2, Fr1, Hspy, MFR, bFGF-R-1, c-fgr)
-
Tag
/ Fusion Protein
- HA-tag (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CMV Forward (CGCAAATGGGCGGTAGGCGTG)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAmplified from a plasmid received from Sabine Werner
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Werner, S., Weinberg, W., Liao, X., Peters, K., Blessing, M., Yuspa, S., Weiner, R., and Williams, L. (1993). Targeted expression of a dominant‐negative FGF receptor mutant in the epidermis of transgenic mice reveals a role of FGF in keratinocyte organization and differentiation. The EMBO Journal 12, 2635-2643.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-CMV-Blast-DNFGFR1-HA was a gift from Gian-Paolo Dotto (Addgene plasmid # 130887 ; http://n2t.net/addgene:130887 ; RRID:Addgene_130887) -
For your References section:
Dualism of FGF and TGF-beta Signaling in Heterogeneous Cancer-Associated Fibroblast Activation with ETV1 as a Critical Determinant. Bordignon P, Bottoni G, Xu X, Popescu AS, Truan Z, Guenova E, Kofler L, Jafari P, Ostano P, Rocken M, Neel V, Dotto GP. Cell Rep. 2019 Aug 27;28(9):2358-2372.e6. doi: 10.1016/j.celrep.2019.07.092. 10.1016/j.celrep.2019.07.092 PubMed 31461652