HES7-NLuc-2A-tdTomato
(Plasmid
#130932)
-
PurposeDonor vector for tagging human HES7 C-terminus with NanoLuc and tdTomato
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130932 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDNR
- Total vector size (bp) 10433
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHES7
-
Alt nameHES7
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1760
-
Entrez GeneHES7 (a.k.a. SCDO4, bHLHb37, hHes7)
-
Tag
/ Fusion Protein
- NanoLuc and tdTomato
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcttggactcctgttgataga
- 3′ sequencing primer ctctgacttgagcgtcgattt (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HES7-NLuc-2A-tdTomato was a gift from James Thomson (Addgene plasmid # 130932 ; http://n2t.net/addgene:130932 ; RRID:Addgene_130932) -
For your References section:
An In Vitro Human Segmentation Clock Model Derived from Embryonic Stem Cells. Chu LF, Mamott D, Ni Z, Bacher R, Liu C, Swanson S, Kendziorski C, Stewart R, Thomson JA. Cell Rep. 2019 Aug 27;28(9):2247-2255.e5. doi: 10.1016/j.celrep.2019.07.090. 10.1016/j.celrep.2019.07.090 PubMed 31461642