Skip to main content

pB-TAG-NICD
(Plasmid #130934)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 130934 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pB-TAG-ERP2
  • Backbone manufacturer
    addgene 80479
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Note: This plasmid is prone to recombination. We recommend testing 2-4 colonies via restriction digest to ensure the full plasmid is intact.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NICD
  • Alt name
    Notch intracellular domain
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2412
  • Entrez Gene
    NOTCH1 (a.k.a. AOS5, AOVD1, TAN1, hN1)
  • Promoter TetO

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer acgtctagaacgtctccctatc
  • 3′ sequencing primer GTCGTCCTTGAAGAAGATGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pB-TAG-NICD was a gift from James Thomson (Addgene plasmid # 130934 ; http://n2t.net/addgene:130934 ; RRID:Addgene_130934)
  • For your References section:

    An In Vitro Human Segmentation Clock Model Derived from Embryonic Stem Cells. Chu LF, Mamott D, Ni Z, Bacher R, Liu C, Swanson S, Kendziorski C, Stewart R, Thomson JA. Cell Rep. 2019 Aug 27;28(9):2247-2255.e5. doi: 10.1016/j.celrep.2019.07.090. 10.1016/j.celrep.2019.07.090 PubMed 31461642