Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Puro-iNotch1IC
(Plasmid #75338)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 75338 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Notch1 Intracellular domain
  • Alt name
    Notch1IC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Notch1 (a.k.a. 9930111A19Rik, Mi, Mis6, N, N1, Ta, Tan1, lin, lin-12)
  • Promoter TRE-tight

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer cagctcaggttctgggagag
  • 3′ sequencing primer gaaatttgtgatgctattgc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene: 15079
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Puro-iNotch1IC was a gift from Danwei Huangfu (Addgene plasmid # 75338 ; http://n2t.net/addgene:75338 ; RRID:Addgene_75338)
  • For your References section:

    Genome Editing of Lineage Determinants in Human Pluripotent Stem Cells Reveals Mechanisms of Pancreatic Development and Diabetes. Zhu Z, Li QV, Lee K, Rosen BP, Gonzalez F, Soh CL, Huangfu D. Cell Stem Cell. 2016 Apr 27. pii: S1934-5909(16)30002-9. doi: 10.1016/j.stem.2016.03.015. 10.1016/j.stem.2016.03.015 PubMed 27133796