-
PurposePiggyBac vector for DOX-inducible human NICD-IRES-EGFP expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130934 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepB-TAG-ERP2
-
Backbone manufactureraddgene 80479
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsNote: This plasmid is prone to recombination. We recommend testing 2-4 colonies via restriction digest to ensure the full plasmid is intact.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNICD
-
Alt nameNotch intracellular domain
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2412
-
Entrez GeneNOTCH1 (a.k.a. AOS5, AOVD1, TAN1, hN1)
- Promoter TetO
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer acgtctagaacgtctccctatc
- 3′ sequencing primer GTCGTCCTTGAAGAAGATGGT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB-TAG-NICD was a gift from James Thomson (Addgene plasmid # 130934 ; http://n2t.net/addgene:130934 ; RRID:Addgene_130934) -
For your References section:
An In Vitro Human Segmentation Clock Model Derived from Embryonic Stem Cells. Chu LF, Mamott D, Ni Z, Bacher R, Liu C, Swanson S, Kendziorski C, Stewart R, Thomson JA. Cell Rep. 2019 Aug 27;28(9):2247-2255.e5. doi: 10.1016/j.celrep.2019.07.090. 10.1016/j.celrep.2019.07.090 PubMed 31461642