pB-TAG-NICD
(Plasmid #130934)

• Purpose: PiggyBac vector for DOX-inducible human NICD-IRES-EGFP expression in mammalian cells
• Depositing Lab: James Thomson
• Publication: Chu et al Cell Rep. 2019 Aug 27;28(9):2247-2255.e5. doi: 10.1016/j.celrep.2019.07.090.

Backbone

• Vector backbone: pB-TAG-ERP2
• Backbone manufacturer: addgene 80479
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Note: This plasmid is prone to recombination. We recommend testing 2-4 colonies via restriction digest to ensure the full plasmid is intact.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NICD
• Alt name: Notch intracellular domain
• Species: H. sapiens (human)
• Insert Size (bp): 2412
• Entrez Gene: NOTCH1 (a.k.a. AOS5, AOVD1, TAN1, hN1)
• Promoter: TetO

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: acgtctagaacgtctccctatc
• 3′ sequencing primer: GTCGTCCTTGAAGAAGATGGT

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry