pLY112
(Plasmid
#130944)
-
PurposeEngineered sgRNA-LEB5 (2 BoxB aptamers) generator circuit including promoter Plux2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130944 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep15AC
-
Backbone manufacturerp15A vector from pdCas9-bacteria (Plasmid #44249)
- Backbone size w/o insert (bp) 1725
- Total vector size (bp) 3004
-
Modifications to backboneAdding 2 BbsI sites for construction
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsCulture in the Lennox’s Luria-Bertani (LB) medium (10 g/L peptone, 5 g/L yeast extract, 5 g/L NaCl)
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesgRNA-LEB5
-
gRNA/shRNA sequenceGGATGAATATATAAGTG
-
SpeciesSynthetic
- Promoter Plux2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (destroyed during cloning)
- 3′ cloning site SpeI (destroyed during cloning)
- 5′ sequencing primer AACGGTCTGGTTATAGGTACATTGAGCAAC
- 3′ sequencing primer GTTCGTAAGCCATTTCCGCTCGCCGCAGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Top10 bacterial strain should be used for downstream applications
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLY112 was a gift from Baojun Wang (Addgene plasmid # 130944 ; http://n2t.net/addgene:130944 ; RRID:Addgene_130944) -
For your References section:
Engineered CRISPRa enables programmable eukaryote-like gene activation in bacteria. Liu Y, Wan X, Wang B. Nat Commun. 2019 Aug 26;10(1):3693. doi: 10.1038/s41467-019-11479-0. 10.1038/s41467-019-11479-0 PubMed 31451697