Skip to main content

pLY134
(Plasmid #130962)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 130962 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSB1K3mut
  • Backbone manufacturer
    Designed by: Austin Che; Mutated by: unknown
  • Backbone size w/o insert (bp) 2204
  • Total vector size (bp) 2470
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Culture in the Lennox’s Luria-Bertani (LB) medium (10 g/L peptone, 5 g/L yeast extract, 5 g/L NaCl)
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA-LEB5
  • gRNA/shRNA sequence
    GGATGAATATATAAGTG
  • Species
    Synthetic
  • Promoter Anderson promoter J23100

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TGCCACTTGACGTCTAAGAA
  • 3′ sequencing primer ATTACCGCCTTTGAGTGAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Top10 bacterial strain should be used for downstream applications

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLY134 was a gift from Baojun Wang (Addgene plasmid # 130962 ; http://n2t.net/addgene:130962 ; RRID:Addgene_130962)
  • For your References section:

    Engineered CRISPRa enables programmable eukaryote-like gene activation in bacteria. Liu Y, Wan X, Wang B. Nat Commun. 2019 Aug 26;10(1):3693. doi: 10.1038/s41467-019-11479-0. 10.1038/s41467-019-11479-0 PubMed 31451697