PX458-3xHA-FnCas9
(Plasmid
#130969)
-
Purpose3xHA tagged Cas9 from F. novicida with T2A-EGFP and cloning backbone for sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130969 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX458
- Backbone size w/o insert (bp) 5023
- Total vector size (bp) 10091
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFnCas9
-
Alt nameFnCas9b
-
SpeciesSynthetic; Francisella tularensis subsp. novicida
-
Insert Size (bp)5068
- Promoter Cbh
-
Tags
/ Fusion Proteins
- 3xHA-NLS (N terminal on insert)
- NLS-T2A-EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site FseI (not destroyed)
- 5′ sequencing primer CBA Forward 5' CTCCGGGCTGTAATTAGCTG 3'
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFnCas9 gene was subcloned from PX408, a gift from Feng Zhang
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX458-3xHA-FnCas9 was a gift from Debojyoti Chakraborty (Addgene plasmid # 130969 ; http://n2t.net/addgene:130969 ; RRID:Addgene_130969) -
For your References section:
Francisella novicida Cas9 interrogates genomic DNA with very high specificity and can be used for mammalian genome editing. Acharya S, Mishra A, Paul D, Ansari AH, Azhar M, Kumar M, Rauthan R, Sharma N, Aich M, Sinha D, Sharma S, Jain S, Ray A, Jain S, Ramalingam S, Maiti S, Chakraborty D. Proc Natl Acad Sci U S A. 2019 Oct 15;116(42):20959-20968. doi: 10.1073/pnas.1818461116. Epub 2019 Sep 30. 10.1073/pnas.1818461116 PubMed 31570623