-
PurposeExpresses both the gePSI-α-chain and the gePSI-β-chain under control of the inducible bi-directional TRE3G promoter. Expresses constitutively AcGFP under control of a CMV promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131008 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV-cDNA6-V5His
-
Backbone manufacturerVector Bioloabs
- Backbone size w/o insert (bp) 3099
- Total vector size (bp) 6619
-
Modifications to backboneThe inserts containing the pTRE3G-Bi-gePSI (α-chain and β-chain-ODC36) with SV40 poly(A) were inserted upstream CMV promoter. AcGFP1 was inserted downstream of the CMV promoter.
-
Vector typeMammalian Expression, AAV
-
Selectable markersNo selectable marker
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namegePSI-β-chain
-
SpeciesZea mays
-
Insert Size (bp)420
- Promoter pTRE3G-Bi
-
Tag
/ Fusion Protein
- murine ornithine decarboxylase - degron (ODC36) (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer pTRE3G_Seq_r: CTCGAGTATGTCGAGGTGG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namegePSI-α-chain
-
SpeciesZea mays
-
Insert Size (bp)426
- Promoter pTRE3G-Bi
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer pTRE3G_Seq_f: GAGAACGTATAAGCTTTAGGC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameAcGFP1
-
SpeciesAequorea coerulescens
-
Insert Size (bp)720
- Promoter pCMV
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV_seq_f: gtgtatcatatgccaagtac
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRE3G-Bi-gePSI-pCMV-AcGFP was a gift from Erin Schuman (Addgene plasmid # 131008 ; http://n2t.net/addgene:131008 ; RRID:Addgene_131008) -
For your References section:
A genetically encodable cell-type-specific protein synthesis inhibitor. Heumuller M, Glock C, Rangaraju V, Biever A, Schuman EM. Nat Methods. 2019 Jul 15. pii: 10.1038/s41592-019-0468-x. doi: 10.1038/s41592-019-0468-x. 10.1038/s41592-019-0468-x PubMed 31308551