pSI-535
(Plasmid
#131130)
-
PurposegRNA expression vector for C-to-T base editing reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131130 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 4005
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameC-to-T reporter activation gRNA
-
gRNA/shRNA sequenceCACGGTCACCCTGACACGCT
-
SpeciesSynthetic
- Promoter Human U6 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer tttcccatgattccttcatattt
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/729269v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSI-535 was a gift from Nozomu Yachie (Addgene plasmid # 131130 ; http://n2t.net/addgene:131130 ; RRID:Addgene_131130) -
For your References section:
Base editors for simultaneous introduction of C-to-T and A-to-G mutations. Sakata RC, Ishiguro S, Mori H, Tanaka M, Tatsuno K, Ueda H, Yamamoto S, Seki M, Masuyama N, Nishida K, Nishimasu H, Arakawa K, Kondo A, Nureki O, Tomita M, Aburatani H, Yachie N. Nat Biotechnol. 2020 Jun 1. pii: 10.1038/s41587-020-0509-0. doi: 10.1038/s41587-020-0509-0. 10.1038/s41587-020-0509-0 PubMed 32483365